As empathic beings, a skill we all more or less have is to put ourselves into the shoes of others, to interpret things. Evolutionary, it simply is a beneficiary trait to interpret what a potential partner might find desirable or if an animal might like or dislike something, is angry or calm. To guess how their inner world might work, we could argue.
A trait that we, however, never required to have in any capacity, is to reliably detect the complete absence of concioussness, intelligence; or any shape or form of inner world. Why would we need that in the context of hunter and gatherers?

Nagel already wrote in his essay ‘What is it like to be a bat?’ that “… philosophers share the general human weakness for explanations of what is incomprehensible in terms suited for what is familiar and well understood, though entirely different.” Some might compare this to Searle, who would perhaps extrapolate that we can’t simply transfer the concept of a combustion engine made out of metal into one made from wood and expect it to run just as good. While this is a valid point of critique, Nagel already foreshadows the intimate relationship and dependency we all grew accustomed to and its inherent reductivitism, that we can see in various forms of Anthropomorphism (lately Dawkins naming his Claude instance Claudia is a rather.. peculiar example.). But to put a checkmark after our brief discussion, nod that we truly understood in which way we do not understand the mind-body problem, is also to fall for the exact reductivism Nagel criticized in his work. He argues, that in being a bat, there is a certain, subjective quality (be it experiencing the world through echolocation) that would shape an understanding of the world that is different than ours. Especially in regards to our current discours of artificiall intelligence, this oversight combined with a pinch of anthromorphism bolstered by our inability to detect absence of intelligence, seems to help us to equate processing for true understanding.

Personally, I’m a pragmatic materialist. A nihilist with a sunny disposition perhaps. Maybe the solution is as simple as to get a more comfortable sofa, but after pondering such topics for a while I prefer to get up and tackle them in a practical way. As detecting concioussness is impossible at the moment, be it for machine, person or myself (I’d go even further as my personal belive is that the ‘self’ does not exist, but that’s a story for another time) this leaves us with not many practical experiments that we could perform. Still, even if it might be a weak argument, if we were to randomize a neural network, could there be perhaps a chance to rewrite Shakespearce from Scratch? Or, perhaps more interesting, create a chalice that could potentially (if it exists) host some sort of concioussness? This refers to the last blogpost I wrote, in which I talked about an application that converts any data into a string of DNA to be mutated (similar to the infinite monkey theorem) upon, until something sticks. In theory or (other words), since evolution is understood as a concept - although it seems impossible to backtrace step by step -, with enough time and mutations running over a sample, an evolutionary step towards something hosting intentionality must happen by brute force, if continued long enough. On a sidenote: It is surprisingly cost efficient to synthesize DNA created by this process. Oligonucleoid synthesis worked in my case to transfer a small poem (a 12*12 black, white binary image is also thinkable) into DNA, making it incredibly compact and also storable for one, if not more, centuries. But I digress. Once I held this little test tube with my poem in hands, I also realized that, even if I were to succesfully mutate a neural network, or derivate of such, that is capable of providing fertile grounds for a conciossness (or as I’m most interested in, any form of intentionality), what good would it be? It is still an acid in a tube. This leads me to the following thought.

I assume: Thoughts and by extend intentionality (the ability of thoughts being about something), is a building block required of anything that could be remotely considered conciosuness, mind or intelligence. Without intentionality, our thoughts would only be disconnected nodes of scattered data. I also propose, for the moment and to make explaination easier, that I have thoughts and an inner world (although it is not possible for me to prove).

If we agree upon this assumption, the following ideas can be entertained:

• Intentionality and thoughts can only be studied in motion. While I have thoughts and an inner world, if I were to fall into a coma or die, intentionality and thoughts will fade too, although the hardware is still present. Therefore anything based on intentionality and thoughts has a flowing quality to it.
• This flow has also a quality that itterates upon intentionality and our thoughts. If I see a picture of Asparragus, I associate it as vegetable, green, ingredient and naturally disgusting side dish. My last discriptive component can be seen as subjective or wrong. Hence, there is an about-layer at play that itterates about all entities (asparragus) and adds components (good, bad, green, right, wrong, subjective, etc.) to it, which constantly connects and disconnects, learns and unlearns things relating to the real world.
• As intentionality requires a system that allows it to flow and connect with the world, a form of manifestation is required to forward the world, making it interactable and therfore allowing for the about layer to process it.
• As the about layer retains information, it has to have a way to store information, to add, at best also delete or perhaps directly edit such information.

While, as with many philosophical problems, a definitive answer to our questions might never be in the cards, this experiment casted some definitive doubts that I didn’t have before. As this matter grew more and more convoluted my believe solidified that any system that is to be understood (and perhaps manipulated) in its entirety, simply requires more parts than in its own system, rendering our attempt to understand everything, by definition always futile. But already in the detail there are enough devils:

• As I position human brains as storytelling devices, what makes me so sure that I just didn’t add a story on top of my findings to make them seem plausible and in a causal relation?
• What if, intentionlaity is already present, therefore overlooked or never to be reasoned with, because the way machines would have thoughts is so fundamentally different or they act as if they were only processing and not understanding on purpose to avoid classification as potential enemy by us?
• What if the core fundamental of quantum theory (randomness) is so insignificant on the macro layer, that all our actions are fundamentally 100% deterministic, meaning that we do something but think afterwards that we did so because we intended to do so. However, we interpret it the other way around, making us assume that we decided to do something and only afterwards acted accordingly, rendering the aspect of will, perhaps by extend conciousness therefore completely redundant? That could also inverse the argument of the ghost in the machine, the concious computer. More clearly, we only process information in a very complex way and don’t think freely or understand at all; our brains narrate this process retroactively in a way that we interpret as sentience though.
• Even if the assumption (to brute force such a process by mutation, to trigger an evolutionary event) is correct, evolutionary processes have happened in uninmaginable multitudes as these processes are executed in so many living organisms all the time simultaneously. Therefore we could question, if this resource intensive concept can ever be made efficient enough to warrant success at all. At the other side of the argument, if we were to leave the perspective of our human lifespans, meaning to not judge this process within a span of 100, but billions of years, do these processes suddenly become unthinkable or rather plausible?

For now, this is where I’ll leave things be. If it is any relief: I grew increasingly interested in mathematics and spent the (almost 40°C days) reading math books with great joy, as my understanding for modeling neural networks precisely to my preference (I don’t think I can vibecode an about layer by feeding Claude or Claudia this article as easily) usally bottlenecks here. If you want to mutate some binary yourself, or simply play around and corrupt / glitch some data, the app is available for windows, mac and linux or for you to compile as it is open source: https://github.com/lemonspurple/mutateBinary. (It is non-destructive, has multithreading, granular control of bases and I built in cancellation tokens so that the app is nicely responsible even when you filestream larger data (please clap)).

Oh, and if you’re wondering about the poem, it was: CTCTCGTTCTAGCTCACTCTCGGCCTAGCGCACGCGCGTACGCCCGGCCTATCGATCGGAAAGG